| Identification |
|---|
| HMDB Protein ID
| HMDBP10830 |
| Secondary Accession Numbers
| |
| Name
| V1-vascular vasopressin receptor AVPR1A |
| Synonyms
|
Not Available
|
| Gene Name
| Not Available |
| Protein Type
| Unknown |
| Biological Properties |
|---|
| General Function
| Involved in receptor activity |
| Specific Function
| Not Available |
| Pathways
|
Not Available
|
| Reactions
| Not Available |
| GO Classification
|
Not Available
|
| Cellular Location
|
Not Available
|
| Gene Properties |
|---|
| Chromosome Location
| Not Available |
| Locus
| Not Available |
| SNPs
| Not Available |
| Gene Sequence
|
>32 bp
ATGCGTCTCTCCGCCGGTCCCGACGCGGGGCC
|
| Protein Properties |
|---|
| Number of Residues
| 11 |
| Molecular Weight
| 1071.2 |
| Theoretical pI
| 6.23 |
| Pfam Domain Function
|
Not Available |
| Signals
|
|
|
Transmembrane Regions
|
|
| Protein Sequence
|
>V1-vascular vasopressin receptor AVPR1A
MRLSAGPDAGP
|
| External Links |
|---|
| GenBank ID Protein
| Not Available |
| UniProtKB/Swiss-Prot ID
| Q9UH72 |
| UniProtKB/Swiss-Prot Entry Name
| Q9UH72_HUMAN |
| PDB IDs
|
Not Available |
| GenBank Gene ID
| AF208541 |
| GeneCard ID
| Not Available |
| GenAtlas ID
| Not Available |
| HGNC ID
| Not Available |
| References |
|---|
| General References
| - Thibonnier M, Graves MK, Wagner MS, Chatelain N, Soubrier F, Corvol P, Willard HF, Jeunemaitre X: Study of V(1)-vascular vasopressin receptor gene microsatellite polymorphisms in human essential hypertension. J Mol Cell Cardiol. 2000 Apr;32(4):557-64. [PubMed:10756113 ]
|
