| Identification |
| HMDB Protein ID
| HMDBP10814 |
| Secondary Accession Numbers
| |
| Name
| Bradykinin B1 receptor |
| Synonyms
|
Not Available
|
| Gene Name
| Not Available |
| Protein Type
| Unknown |
| Biological Properties |
| General Function
| Involved in receptor activity |
| Specific Function
| Not Available |
| Pathways
|
Not Available
|
| Reactions
| Not Available |
| GO Classification
|
Not Available
|
| Cellular Location
|
Not Available
|
| Gene Properties |
| Chromosome Location
| Not Available |
| Locus
| Not Available |
| SNPs
| Not Available |
| Gene Sequence
|
>57 bp
GCTCCAATATCTTCATCCCATAGGAAAGAAATCTTCCAACTTTTCTGGCGGAATTAA
|
| Protein Properties |
| Number of Residues
| 18 |
| Molecular Weight
| 2216.5 |
| Theoretical pI
| 11.48 |
| Pfam Domain Function
|
Not Available |
| Signals
|
|
|
Transmembrane Regions
|
|
| Protein Sequence
|
>Bradykinin B1 receptor
APISSSHRKEIFQLFWRN
|
| External Links |
| GenBank ID Protein
| Not Available |
| UniProtKB/Swiss-Prot ID
| Q71U72 |
| UniProtKB/Swiss-Prot Entry Name
| Q71U72_HUMAN |
| PDB IDs
|
Not Available |
| GenBank Gene ID
| AF117819 |
| GeneCard ID
| Not Available |
| GenAtlas ID
| Not Available |
| HGNC ID
| Not Available |
| References |
| General References
| - Zhou X, Prado GN, Chai M, Yang X, Taylor L, Polgar P: Posttranscriptional destabilization of the bradykinin B1 receptor messenger RNA: cloning and functional characterization of the 3'-untranslated region. Mol Cell Biol Res Commun. 1999 Apr;1(1):29-35. [PubMed:10329474 ]
|