| Identification |
|---|
| HMDB Protein ID
| HMDBP10780 |
| Secondary Accession Numbers
| |
| Name
| Solute carrier family 19 thiamine transporter member 2 |
| Synonyms
|
Not Available
|
| Gene Name
| SLC19A2 |
| Protein Type
| Unknown |
| Biological Properties |
|---|
| General Function
| Not Available |
| Specific Function
| Not Available |
| Pathways
|
Not Available
|
| Reactions
| Not Available |
| GO Classification
|
Not Available
|
| Cellular Location
|
Not Available
|
| Gene Properties |
|---|
| Chromosome Location
| Chromosome:1 |
| Locus
| 1q23.3 |
| SNPs
| SLC19A2 |
| Gene Sequence
|
>47 bp
ATGGATGTGCCCGGCCCGGTGTCTCGGCGGGCGGCGGCGGCGGCGGC
|
| Protein Properties |
|---|
| Number of Residues
| 16 |
| Molecular Weight
| 1539.7 |
| Theoretical pI
| 10.45 |
| Pfam Domain Function
|
Not Available |
| Signals
|
|
|
Transmembrane Regions
|
|
| Protein Sequence
|
>Solute carrier family 19 thiamine transporter member 2
MDVPGPVSRRAAAAAA
|
| External Links |
|---|
| GenBank ID Protein
| 164370706 |
| UniProtKB/Swiss-Prot ID
| B0FBR7 |
| UniProtKB/Swiss-Prot Entry Name
| B0FBR7_HUMAN |
| PDB IDs
|
Not Available |
| GenBank Gene ID
| EU302825 |
| GeneCard ID
| SLC19A2 |
| GenAtlas ID
| Not Available |
| HGNC ID
| Not Available |
| References |
|---|
| General References
| - Fleming JC, Tartaglini E, Steinkamp MP, Schorderet DF, Cohen N, Neufeld EJ: The gene mutated in thiamine-responsive anaemia with diabetes and deafness (TRMA) encodes a functional thiamine transporter. Nat Genet. 1999 Jul;22(3):305-8. [PubMed:10391222 ]
|
