Hmdb loader
Identification
HMDB Protein ID HMDBP10773
Secondary Accession Numbers
  • 17042
Name Norepinephrine transporter
Synonyms Not Available
Gene Name NET
Protein Type Unknown
Biological Properties
General Function Not Available
Specific Function Not Available
Pathways Not Available
Reactions Not Available
GO Classification Not Available
Cellular Location Not Available
Gene Properties
Chromosome Location Not Available
Locus Not Available
SNPs NET
Gene Sequence
>54 bp
ATGCTTCTGGCGCGGATGAACCCGCAGGTGCAGCCCGAGAACAACGGGGCGGAC
Protein Properties
Number of Residues 18
Molecular Weight 1998.3
Theoretical pI 4.19
Pfam Domain Function Not Available
Signals
  • None
Transmembrane Regions
  • None
Protein Sequence
>Norepinephrine transporter
MLLARMNPQVQPENNGAD
GenBank ID Protein 4335929
UniProtKB/Swiss-Prot ID Q71UR5
UniProtKB/Swiss-Prot Entry Name Q71UR5_HUMAN
PDB IDs Not Available
GenBank Gene ID AF061198
GeneCard ID NET
GenAtlas ID Not Available
HGNC ID Not Available
References
General References
  1. Kim CH, Kim HS, Cubells JF, Kim KS: A previously undescribed intron and extensive 5' upstream sequence, but not Phox2a-mediated transactivation, are necessary for high level cell type-specific expression of the human norepinephrine transporter gene. J Biol Chem. 1999 Mar 5;274(10):6507-18. [PubMed:10037744 ]