| Identification |
|---|
| HMDB Protein ID
| HMDBP10773 |
| Secondary Accession Numbers
| |
| Name
| Norepinephrine transporter |
| Synonyms
|
Not Available
|
| Gene Name
| NET |
| Protein Type
| Unknown |
| Biological Properties |
|---|
| General Function
| Not Available |
| Specific Function
| Not Available |
| Pathways
|
Not Available
|
| Reactions
| Not Available |
| GO Classification
|
Not Available
|
| Cellular Location
|
Not Available
|
| Gene Properties |
|---|
| Chromosome Location
| Not Available |
| Locus
| Not Available |
| SNPs
| NET |
| Gene Sequence
|
>54 bp
ATGCTTCTGGCGCGGATGAACCCGCAGGTGCAGCCCGAGAACAACGGGGCGGAC
|
| Protein Properties |
|---|
| Number of Residues
| 18 |
| Molecular Weight
| 1998.3 |
| Theoretical pI
| 4.19 |
| Pfam Domain Function
|
Not Available |
| Signals
|
|
|
Transmembrane Regions
|
|
| Protein Sequence
|
>Norepinephrine transporter
MLLARMNPQVQPENNGAD
|
| External Links |
|---|
| GenBank ID Protein
| 4335929 |
| UniProtKB/Swiss-Prot ID
| Q71UR5 |
| UniProtKB/Swiss-Prot Entry Name
| Q71UR5_HUMAN |
| PDB IDs
|
Not Available |
| GenBank Gene ID
| AF061198 |
| GeneCard ID
| NET |
| GenAtlas ID
| Not Available |
| HGNC ID
| Not Available |
| References |
|---|
| General References
| - Kim CH, Kim HS, Cubells JF, Kim KS: A previously undescribed intron and extensive 5' upstream sequence, but not Phox2a-mediated transactivation, are necessary for high level cell type-specific expression of the human norepinephrine transporter gene. J Biol Chem. 1999 Mar 5;274(10):6507-18. [PubMed:10037744 ]
|
